fragment sizes (New England Biolabs)
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 
98
Structured Review
New England Biolabs
fragment sizes
Fragment Sizes, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 565 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/1+kb+plus+dna+ladder/1+kb+Plus+DNA+Ladder/10__1093_slash_najfmt_slash_vqag024-83-9-20
Average 98 stars, based on 565 article reviews
Fragment Sizes, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 565 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/1+kb+plus+dna+ladder/1+kb+Plus+DNA+Ladder/10__1093_slash_najfmt_slash_vqag024-83-9-20
Average 98 stars, based on 565 article reviews
fragment sizes - by Bioz Stars,
2026-09
98/100 stars
Images
Related Articles
Marker:Article Title: Comparing Symptoms and Virus Accumulation of Three Tobamoviruses in Cucurbitaceae Hosts Article Snippet: .. Lane 437 M: size marker, Sterility:Article Title: CRISPR/Cas9-Mediated Gene Knockout in Cereal Crops. Article Snippet: .. Materials Predesigned and tested screening primer pairs (see Basic Protocols 1 and 2) Taq 2× Master Mix (New England Biolabs, cat. no. M0270) Template DNA (see Support Protocol 1) H2O, sterile nuclease-free Exo-CIP Rapid PCR Cleanup Kit (New England Biolabs, cat. no. E1050S) CloneJET PCR Cloning Kit (Thermo Fisher Scientific, cat. no. K1231) Article Title: CRISPR/Cas9‐Mediated Gene Knockout in Cereal Crops Article Snippet: .. Predesigned and tested screening primer pairs (see Basic Protocols and ) Taq 2× Master Mix (New England Biolabs, cat. no. M0270) Template DNA (see Support Protocol ) H2O, sterile nuclease‐free Exo‐CIP Rapid PCR Cleanup Kit (New England Biolabs, cat. no. E1050S) CloneJET PCR Cloning Kit (Thermo Fisher Scientific, cat. no. K1231) Polymerase Chain Reaction:Article Title: CRISPR/Cas9-Mediated Gene Knockout in Cereal Crops. Article Snippet: .. Materials Predesigned and tested screening primer pairs (see Basic Protocols 1 and 2) Taq 2× Master Mix (New England Biolabs, cat. no. M0270) Template DNA (see Support Protocol 1) H2O, sterile nuclease-free Exo-CIP Rapid PCR Cleanup Kit (New England Biolabs, cat. no. E1050S) CloneJET PCR Cloning Kit (Thermo Fisher Scientific, cat. no. K1231) Article Title: CRISPR/Cas9‐Mediated Gene Knockout in Cereal Crops Article Snippet: .. Predesigned and tested screening primer pairs (see Basic Protocols and ) Taq 2× Master Mix (New England Biolabs, cat. no. M0270) Template DNA (see Support Protocol ) H2O, sterile nuclease‐free Exo‐CIP Rapid PCR Cleanup Kit (New England Biolabs, cat. no. E1050S) CloneJET PCR Cloning Kit (Thermo Fisher Scientific, cat. no. K1231) Article Title: CRISPR/Cas9-Mediated Gene Knockout in Cereal Crops. Article Snippet: .. Materials 2× Q5 High-Fidelity Master Mix (New England Biolabs, cat. no. M0492) ∼100 ng/μl template gDNA (see Support Protocol 1) Forward and reverse primers ddH2O 1% agarose gel (see recipe) 20,000× RedSafe (iNtRON Biotechnology, cat. no. 21141) Gel loading dye, purple (New England Biolabs, cat. no. B7024S) Article Title: CRISPR/Cas9‐Mediated Gene Knockout in Cereal Crops Article Snippet: .. 2× Q5 High‐Fidelity Master Mix (New England Biolabs, cat. no. M0492) ∼100 ng/μl template gDNA (see Support Protocol ) Forward and reverse primers ddH 2 O 1% agarose gel (see recipe) 20,000× RedSafe (iNtRON Biotechnology, cat. no. 21141) Gel loading dye, purple (New England Biolabs, cat. no. B7024S) Cloning:Article Title: CRISPR/Cas9-Mediated Gene Knockout in Cereal Crops. Article Snippet: .. Materials Predesigned and tested screening primer pairs (see Basic Protocols 1 and 2) Taq 2× Master Mix (New England Biolabs, cat. no. M0270) Template DNA (see Support Protocol 1) H2O, sterile nuclease-free Exo-CIP Rapid PCR Cleanup Kit (New England Biolabs, cat. no. E1050S) CloneJET PCR Cloning Kit (Thermo Fisher Scientific, cat. no. K1231) Article Title: CRISPR/Cas9‐Mediated Gene Knockout in Cereal Crops Article Snippet: .. Predesigned and tested screening primer pairs (see Basic Protocols and ) Taq 2× Master Mix (New England Biolabs, cat. no. M0270) Template DNA (see Support Protocol ) H2O, sterile nuclease‐free Exo‐CIP Rapid PCR Cleanup Kit (New England Biolabs, cat. no. E1050S) CloneJET PCR Cloning Kit (Thermo Fisher Scientific, cat. no. K1231) Nucleic Acid Electrophoresis:Article Title: CRISPR/Cas9-Mediated Gene Knockout in Cereal Crops. Article Snippet: .. Materials Predesigned and tested screening primer pairs (see Basic Protocols 1 and 2) Taq 2× Master Mix (New England Biolabs, cat. no. M0270) Template DNA (see Support Protocol 1) H2O, sterile nuclease-free Exo-CIP Rapid PCR Cleanup Kit (New England Biolabs, cat. no. E1050S) CloneJET PCR Cloning Kit (Thermo Fisher Scientific, cat. no. K1231) Article Title: CRISPR/Cas9‐Mediated Gene Knockout in Cereal Crops Article Snippet: .. Predesigned and tested screening primer pairs (see Basic Protocols and ) Taq 2× Master Mix (New England Biolabs, cat. no. M0270) Template DNA (see Support Protocol ) H2O, sterile nuclease‐free Exo‐CIP Rapid PCR Cleanup Kit (New England Biolabs, cat. no. E1050S) CloneJET PCR Cloning Kit (Thermo Fisher Scientific, cat. no. K1231) Article Title: CRISPR/Cas9‐Mediated Gene Knockout in Cereal Crops Article Snippet: .. T4 Polynucleotide Kinase (PNK) (New England Biolabs, cat. no. M0201L) T4 DNA ligase and its accompanying 10× buffer (New England Biolabs, cat. no. M0202L) Annealing buffer (see recipe) Escherichia coli DH5α competent cells (New England Biolabs, C2987, or in‐house prepared) LB liquid medium, 10‐ml aliquots (see recipe) LB solid plates, spectinomycin, 100 μg/ml (see recipe) LB spectinomycin medium (see recipe) Plasmid DNA Miniprep Kit (Monarch Miniprep Kit, New England Biolabs, cat. no. T1110L) Universal sequencing primers: TOsU6.2‐HindIII‐R1, 5'‐TTCAAGCTTATCGATACCCTC‐3 ́ M13 Forward, 5 ́‐CCCAGTCACGACGTTGTAAAACG‐3 ́ M13 Reverse, 5’‐CAGGAAACAGCTATGAC‐3’ Bsa I‐HF enzyme (New England Biolabs, cat. no. R3733L) Gateway LR Clonase II Enzyme mix (Thermo Fisher Scientific, cat. no. 11791020) LB solid plates, kanamycin, 50 μg/ml (see recipe) 50 mg/ml kanamycin (see recipe) Pvu II (New England Biolabs, cat. no. R3151) 20,000× RedSafe (iNtRON Biotechnology, cat. no. 21141) Article Title: CRISPR/Cas9-Mediated Gene Knockout in Cereal Crops. Article Snippet: T4 Polynucleotide Kinase (PNK) (New England Biolabs, cat. no. M0201L) T4 DNA ligase and its accompanying 10× buffer (New England Biolabs, cat. no. M0202L) Annealing buffer (see recipe) Escherichia coli DH5α competent cells (New England Biolabs, C2987, or in-house prepared) LB liquid medium, 10-ml aliquots (see recipe) LB solid plates, spectinomycin, 100 μg/ml (see recipe) LB spectinomycin medium (see recipe) Plasmid DNA Miniprep Kit (Monarch Miniprep Kit, New England Biolabs, cat. no. T1110L) Universal sequencing primers: TOsU6.2-HindIII-R1, 5’-TTCAAGCTTATCGATACCCTC-3 ́ M13 Forward, 5 ́-CCCAGTCACGACGTTGTAAAACG-3 ́ M13 Reverse, 5’-CAGGAAACAGCTATGAC-3’Pramanik et al. 12 of 28 Current Protocols 26911299, 2025, 9, D ow nloaded from https://currentprotocols.onlinelibrary.w iley.com /doi/10.1002/cpz1.70210 by N at Prov Indonesia, W iley O nline L ibrary on [27/09/2025]. .. See the T erm s and C onditions (https://onlinelibrary.w iley.com /term s-and-conditions) on W iley O nline L ibrary for rules of use; O A articles are governed by the applicable C reative C om m ons L icense BsaI-HF enzyme (New England Biolabs, cat. no. R3733L) Gateway LR Clonase II Enzyme mix (Thermo Fisher Scientific, cat. no. 11791020) LB solid plates, kanamycin, 50 μg/ml (see recipe) 50 mg/ml kanamycin (see recipe) PvuII (New England Biolabs, cat. no. R3151) 20,000× RedSafe (iNtRON Biotechnology, cat. no. 21141) Agarose Gel Electrophoresis:Article Title: CRISPR/Cas9-Mediated Gene Knockout in Cereal Crops. Article Snippet: .. Materials 2× Q5 High-Fidelity Master Mix (New England Biolabs, cat. no. M0492) ∼100 ng/μl template gDNA (see Support Protocol 1) Forward and reverse primers ddH2O 1% agarose gel (see recipe) 20,000× RedSafe (iNtRON Biotechnology, cat. no. 21141) Gel loading dye, purple (New England Biolabs, cat. no. B7024S) Article Title: CRISPR/Cas9‐Mediated Gene Knockout in Cereal Crops Article Snippet: .. 2× Q5 High‐Fidelity Master Mix (New England Biolabs, cat. no. M0492) ∼100 ng/μl template gDNA (see Support Protocol ) Forward and reverse primers ddH 2 O 1% agarose gel (see recipe) 20,000× RedSafe (iNtRON Biotechnology, cat. no. 21141) Gel loading dye, purple (New England Biolabs, cat. no. B7024S) Purification:Article Title: CRISPR/Cas9-Mediated Gene Knockout in Cereal Crops. Article Snippet: .. Materials 2× Q5 High-Fidelity Master Mix (New England Biolabs, cat. no. M0492) ∼100 ng/μl template gDNA (see Support Protocol 1) Forward and reverse primers ddH2O 1% agarose gel (see recipe) 20,000× RedSafe (iNtRON Biotechnology, cat. no. 21141) Gel loading dye, purple (New England Biolabs, cat. no. B7024S) Article Title: CRISPR/Cas9‐Mediated Gene Knockout in Cereal Crops Article Snippet: .. 2× Q5 High‐Fidelity Master Mix (New England Biolabs, cat. no. M0492) ∼100 ng/μl template gDNA (see Support Protocol ) Forward and reverse primers ddH 2 O 1% agarose gel (see recipe) 20,000× RedSafe (iNtRON Biotechnology, cat. no. 21141) Gel loading dye, purple (New England Biolabs, cat. no. B7024S) Plasmid Preparation:Article Title: CRISPR/Cas9‐Mediated Gene Knockout in Cereal Crops Article Snippet: .. T4 Polynucleotide Kinase (PNK) (New England Biolabs, cat. no. M0201L) T4 DNA ligase and its accompanying 10× buffer (New England Biolabs, cat. no. M0202L) Annealing buffer (see recipe) Escherichia coli DH5α competent cells (New England Biolabs, C2987, or in‐house prepared) LB liquid medium, 10‐ml aliquots (see recipe) LB solid plates, spectinomycin, 100 μg/ml (see recipe) LB spectinomycin medium (see recipe) Plasmid DNA Miniprep Kit (Monarch Miniprep Kit, New England Biolabs, cat. no. T1110L) Universal sequencing primers: TOsU6.2‐HindIII‐R1, 5'‐TTCAAGCTTATCGATACCCTC‐3 ́ M13 Forward, 5 ́‐CCCAGTCACGACGTTGTAAAACG‐3 ́ M13 Reverse, 5’‐CAGGAAACAGCTATGAC‐3’ Bsa I‐HF enzyme (New England Biolabs, cat. no. R3733L) Gateway LR Clonase II Enzyme mix (Thermo Fisher Scientific, cat. no. 11791020) LB solid plates, kanamycin, 50 μg/ml (see recipe) 50 mg/ml kanamycin (see recipe) Pvu II (New England Biolabs, cat. no. R3151) 20,000× RedSafe (iNtRON Biotechnology, cat. no. 21141) Article Title: CRISPR/Cas9-Mediated Gene Knockout in Cereal Crops. Article Snippet: T4 Polynucleotide Kinase (PNK) (New England Biolabs, cat. no. M0201L) T4 DNA ligase and its accompanying 10× buffer (New England Biolabs, cat. no. M0202L) Annealing buffer (see recipe) Escherichia coli DH5α competent cells (New England Biolabs, C2987, or in-house prepared) LB liquid medium, 10-ml aliquots (see recipe) LB solid plates, spectinomycin, 100 μg/ml (see recipe) LB spectinomycin medium (see recipe) Plasmid DNA Miniprep Kit (Monarch Miniprep Kit, New England Biolabs, cat. no. T1110L) Universal sequencing primers: TOsU6.2-HindIII-R1, 5’-TTCAAGCTTATCGATACCCTC-3 ́ M13 Forward, 5 ́-CCCAGTCACGACGTTGTAAAACG-3 ́ M13 Reverse, 5’-CAGGAAACAGCTATGAC-3’Pramanik et al. 12 of 28 Current Protocols 26911299, 2025, 9, D ow nloaded from https://currentprotocols.onlinelibrary.w iley.com /doi/10.1002/cpz1.70210 by N at Prov Indonesia, W iley O nline L ibrary on [27/09/2025]. .. See the T erm s and C onditions (https://onlinelibrary.w iley.com /term s-and-conditions) on W iley O nline L ibrary for rules of use; O A articles are governed by the applicable C reative C om m ons L icense BsaI-HF enzyme (New England Biolabs, cat. no. R3733L) Gateway LR Clonase II Enzyme mix (Thermo Fisher Scientific, cat. no. 11791020) LB solid plates, kanamycin, 50 μg/ml (see recipe) 50 mg/ml kanamycin (see recipe) PvuII (New England Biolabs, cat. no. R3151) 20,000× RedSafe (iNtRON Biotechnology, cat. no. 21141) Sequencing:Article Title: CRISPR/Cas9‐Mediated Gene Knockout in Cereal Crops Article Snippet: .. T4 Polynucleotide Kinase (PNK) (New England Biolabs, cat. no. M0201L) T4 DNA ligase and its accompanying 10× buffer (New England Biolabs, cat. no. M0202L) Annealing buffer (see recipe) Escherichia coli DH5α competent cells (New England Biolabs, C2987, or in‐house prepared) LB liquid medium, 10‐ml aliquots (see recipe) LB solid plates, spectinomycin, 100 μg/ml (see recipe) LB spectinomycin medium (see recipe) Plasmid DNA Miniprep Kit (Monarch Miniprep Kit, New England Biolabs, cat. no. T1110L) Universal sequencing primers: TOsU6.2‐HindIII‐R1, 5'‐TTCAAGCTTATCGATACCCTC‐3 ́ M13 Forward, 5 ́‐CCCAGTCACGACGTTGTAAAACG‐3 ́ M13 Reverse, 5’‐CAGGAAACAGCTATGAC‐3’ Bsa I‐HF enzyme (New England Biolabs, cat. no. R3733L) Gateway LR Clonase II Enzyme mix (Thermo Fisher Scientific, cat. no. 11791020) LB solid plates, kanamycin, 50 μg/ml (see recipe) 50 mg/ml kanamycin (see recipe) Pvu II (New England Biolabs, cat. no. R3151) 20,000× RedSafe (iNtRON Biotechnology, cat. no. 21141) Blocking Assay:Article Title: CRISPR/Cas9‐Mediated Gene Knockout in Cereal Crops Article Snippet: .. T4 Polynucleotide Kinase (PNK) (New England Biolabs, cat. no. M0201L) T4 DNA ligase and its accompanying 10× buffer (New England Biolabs, cat. no. M0202L) Annealing buffer (see recipe) Escherichia coli DH5α competent cells (New England Biolabs, C2987, or in‐house prepared) LB liquid medium, 10‐ml aliquots (see recipe) LB solid plates, spectinomycin, 100 μg/ml (see recipe) LB spectinomycin medium (see recipe) Plasmid DNA Miniprep Kit (Monarch Miniprep Kit, New England Biolabs, cat. no. T1110L) Universal sequencing primers: TOsU6.2‐HindIII‐R1, 5'‐TTCAAGCTTATCGATACCCTC‐3 ́ M13 Forward, 5 ́‐CCCAGTCACGACGTTGTAAAACG‐3 ́ M13 Reverse, 5’‐CAGGAAACAGCTATGAC‐3’ Bsa I‐HF enzyme (New England Biolabs, cat. no. R3733L) Gateway LR Clonase II Enzyme mix (Thermo Fisher Scientific, cat. no. 11791020) LB solid plates, kanamycin, 50 μg/ml (see recipe) 50 mg/ml kanamycin (see recipe) Pvu II (New England Biolabs, cat. no. R3151) 20,000× RedSafe (iNtRON Biotechnology, cat. no. 21141) Article Title: CRISPR/Cas9-Mediated Gene Knockout in Cereal Crops. Article Snippet: T4 Polynucleotide Kinase (PNK) (New England Biolabs, cat. no. M0201L) T4 DNA ligase and its accompanying 10× buffer (New England Biolabs, cat. no. M0202L) Annealing buffer (see recipe) Escherichia coli DH5α competent cells (New England Biolabs, C2987, or in-house prepared) LB liquid medium, 10-ml aliquots (see recipe) LB solid plates, spectinomycin, 100 μg/ml (see recipe) LB spectinomycin medium (see recipe) Plasmid DNA Miniprep Kit (Monarch Miniprep Kit, New England Biolabs, cat. no. T1110L) Universal sequencing primers: TOsU6.2-HindIII-R1, 5’-TTCAAGCTTATCGATACCCTC-3 ́ M13 Forward, 5 ́-CCCAGTCACGACGTTGTAAAACG-3 ́ M13 Reverse, 5’-CAGGAAACAGCTATGAC-3’Pramanik et al. 12 of 28 Current Protocols 26911299, 2025, 9, D ow nloaded from https://currentprotocols.onlinelibrary.w iley.com /doi/10.1002/cpz1.70210 by N at Prov Indonesia, W iley O nline L ibrary on [27/09/2025]. .. See the T erm s and C onditions (https://onlinelibrary.w iley.com /term s-and-conditions) on W iley O nline L ibrary for rules of use; O A articles are governed by the applicable C reative C om m ons L icense BsaI-HF enzyme (New England Biolabs, cat. no. R3733L) Gateway LR Clonase II Enzyme mix (Thermo Fisher Scientific, cat. no. 11791020) LB solid plates, kanamycin, 50 μg/ml (see recipe) 50 mg/ml kanamycin (see recipe) PvuII (New England Biolabs, cat. no. R3151) 20,000× RedSafe (iNtRON Biotechnology, cat. no. 21141) Spectrophotometry:Article Title: CRISPR/Cas9‐Mediated Gene Knockout in Cereal Crops Article Snippet: .. T4 Polynucleotide Kinase (PNK) (New England Biolabs, cat. no. M0201L) T4 DNA ligase and its accompanying 10× buffer (New England Biolabs, cat. no. M0202L) Annealing buffer (see recipe) Escherichia coli DH5α competent cells (New England Biolabs, C2987, or in‐house prepared) LB liquid medium, 10‐ml aliquots (see recipe) LB solid plates, spectinomycin, 100 μg/ml (see recipe) LB spectinomycin medium (see recipe) Plasmid DNA Miniprep Kit (Monarch Miniprep Kit, New England Biolabs, cat. no. T1110L) Universal sequencing primers: TOsU6.2‐HindIII‐R1, 5'‐TTCAAGCTTATCGATACCCTC‐3 ́ M13 Forward, 5 ́‐CCCAGTCACGACGTTGTAAAACG‐3 ́ M13 Reverse, 5’‐CAGGAAACAGCTATGAC‐3’ Bsa I‐HF enzyme (New England Biolabs, cat. no. R3733L) Gateway LR Clonase II Enzyme mix (Thermo Fisher Scientific, cat. no. 11791020) LB solid plates, kanamycin, 50 μg/ml (see recipe) 50 mg/ml kanamycin (see recipe) Pvu II (New England Biolabs, cat. no. R3151) 20,000× RedSafe (iNtRON Biotechnology, cat. no. 21141) Article Title: CRISPR/Cas9-Mediated Gene Knockout in Cereal Crops. Article Snippet: T4 Polynucleotide Kinase (PNK) (New England Biolabs, cat. no. M0201L) T4 DNA ligase and its accompanying 10× buffer (New England Biolabs, cat. no. M0202L) Annealing buffer (see recipe) Escherichia coli DH5α competent cells (New England Biolabs, C2987, or in-house prepared) LB liquid medium, 10-ml aliquots (see recipe) LB solid plates, spectinomycin, 100 μg/ml (see recipe) LB spectinomycin medium (see recipe) Plasmid DNA Miniprep Kit (Monarch Miniprep Kit, New England Biolabs, cat. no. T1110L) Universal sequencing primers: TOsU6.2-HindIII-R1, 5’-TTCAAGCTTATCGATACCCTC-3 ́ M13 Forward, 5 ́-CCCAGTCACGACGTTGTAAAACG-3 ́ M13 Reverse, 5’-CAGGAAACAGCTATGAC-3’Pramanik et al. 12 of 28 Current Protocols 26911299, 2025, 9, D ow nloaded from https://currentprotocols.onlinelibrary.w iley.com /doi/10.1002/cpz1.70210 by N at Prov Indonesia, W iley O nline L ibrary on [27/09/2025]. .. See the T erm s and C onditions (https://onlinelibrary.w iley.com /term s-and-conditions) on W iley O nline L ibrary for rules of use; O A articles are governed by the applicable C reative C om m ons L icense BsaI-HF enzyme (New England Biolabs, cat. no. R3733L) Gateway LR Clonase II Enzyme mix (Thermo Fisher Scientific, cat. no. 11791020) LB solid plates, kanamycin, 50 μg/ml (see recipe) 50 mg/ml kanamycin (see recipe) PvuII (New England Biolabs, cat. no. R3151) 20,000× RedSafe (iNtRON Biotechnology, cat. no. 21141) other:Article Title: Efficient Whole-Genome Sequencing of Monkeypox Virus Using a Novel Nuclease-Multiple Displacement Amplification Enrichment Method Article Snippet: Lane assignments: M, |